ID: 905888497_905888505

View in Genome Browser

Spacer: 16

Left Crispr Right Crispr
Crispr ID 905888497 905888505
Species Human (GRCh38) Human (GRCh38)
Location 1:41504806-41504828 1:41504845-41504867
Sequence CCAAATAGACACACTGACTTCAT CCCTCCTTTTAGGCCACTGTGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 16, 4: 167} {0: 1, 1: 0, 2: 1, 3: 9, 4: 106}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!