ID: 905904432_905904437

View in Genome Browser

Spacer: 17

Left Crispr Right Crispr
Crispr ID 905904432 905904437
Species Human (GRCh38) Human (GRCh38)
Location 1:41608427-41608449 1:41608467-41608489
Sequence CCTTAGAGAGCATTTGTTGGGGA TGCCTGCCTCTTTGTGAAGAAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 11, 4: 127} {0: 1, 1: 1, 2: 34, 3: 402, 4: 1699}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!