ID: 905910038_905910041

View in Genome Browser

Spacer: 24

Left Crispr Right Crispr
Crispr ID 905910038 905910041
Species Human (GRCh38) Human (GRCh38)
Location 1:41647431-41647453 1:41647478-41647500
Sequence CCGGGCACAAGCTGTTTCCACAG CAGAAATAACCCCACTGACATGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 3, 3: 12, 4: 216} {0: 1, 1: 1, 2: 0, 3: 28, 4: 217}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!