ID: 905926972_905926989

View in Genome Browser

Spacer: 27

Left Crispr Right Crispr
Crispr ID 905926972 905926989
Species Human (GRCh38) Human (GRCh38)
Location 1:41758156-41758178 1:41758206-41758228
Sequence CCAACCAAGGCTGCCTTCCCCGG TTCCCAGGGCTCTGGTGTGAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 3, 3: 22, 4: 197} {0: 1, 1: 0, 2: 2, 3: 48, 4: 332}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!