ID: 905938100_905938111

View in Genome Browser

Spacer: 20

Left Crispr Right Crispr
Crispr ID 905938100 905938111
Species Human (GRCh38) Human (GRCh38)
Location 1:41840735-41840757 1:41840778-41840800
Sequence CCGTGCCAGCCAGCCAGTCACTG CTTGGCACTGGAAGGAGGCCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 6, 3: 33, 4: 382} {0: 1, 1: 1, 2: 1, 3: 20, 4: 320}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!