ID: 905938884_905938894

View in Genome Browser

Spacer: 27

Left Crispr Right Crispr
Crispr ID 905938884 905938894
Species Human (GRCh38) Human (GRCh38)
Location 1:41846974-41846996 1:41847024-41847046
Sequence CCAGGCAAGGCAACGGAAGCCAG CATCCAGGAAAGGGCATATGTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 3, 3: 20, 4: 266} {0: 1, 1: 0, 2: 5, 3: 39, 4: 283}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!