ID: 905956656_905956661

View in Genome Browser

Spacer: -2

Left Crispr Right Crispr
Crispr ID 905956656 905956661
Species Human (GRCh38) Human (GRCh38)
Location 1:42002711-42002733 1:42002732-42002754
Sequence CCCTGGGGTTCCACTCTCCTGTA TACAAGTCAGTAGCCCAAAAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 148} {0: 1, 1: 0, 2: 0, 3: 14, 4: 206}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!