ID: 905959954_905959963

View in Genome Browser

Spacer: -8

Left Crispr Right Crispr
Crispr ID 905959954 905959963
Species Human (GRCh38) Human (GRCh38)
Location 1:42035527-42035549 1:42035542-42035564
Sequence CCCCCGCCCCAGGACCGGAGGTT CGGAGGTTGTGTAATCGGCCCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 7, 4: 159} {0: 1, 1: 0, 2: 0, 3: 1, 4: 21}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!