ID: 905982447_905982450

View in Genome Browser

Spacer: 5

Left Crispr Right Crispr
Crispr ID 905982447 905982450
Species Human (GRCh38) Human (GRCh38)
Location 1:42241735-42241757 1:42241763-42241785
Sequence CCAGGGGAATGAGGACACACCAC CAGCCCACTGCTGCCACTGTCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 15, 4: 146} {0: 1, 1: 2, 2: 14, 3: 70, 4: 312}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!