ID: 905995313_905995319

View in Genome Browser

Spacer: 15

Left Crispr Right Crispr
Crispr ID 905995313 905995319
Species Human (GRCh38) Human (GRCh38)
Location 1:42376303-42376325 1:42376341-42376363
Sequence CCCAGGGAAGGATTATATTTCCT CAGGTGTGGCCAGGTGAACTTGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 4, 3: 31, 4: 254}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!