ID: 906023811_906023815

View in Genome Browser

Spacer: 0

Left Crispr Right Crispr
Crispr ID 906023811 906023815
Species Human (GRCh38) Human (GRCh38)
Location 1:42655963-42655985 1:42655986-42656008
Sequence CCCATGCTTAAGTGATCCTCTCT CCTCAGCCTCTCCCAAGTACAGG
Strand - +
Off-target summary {0: 1, 1: 5, 2: 65, 3: 1154, 4: 9879} {0: 1, 1: 3, 2: 22, 3: 243, 4: 1020}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!