ID: 906023812_906023815

View in Genome Browser

Spacer: -1

Left Crispr Right Crispr
Crispr ID 906023812 906023815
Species Human (GRCh38) Human (GRCh38)
Location 1:42655964-42655986 1:42655986-42656008
Sequence CCATGCTTAAGTGATCCTCTCTC CCTCAGCCTCTCCCAAGTACAGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 62, 3: 931, 4: 6406} {0: 1, 1: 3, 2: 22, 3: 243, 4: 1020}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!