ID: 906027052_906027070

View in Genome Browser

Spacer: 30

Left Crispr Right Crispr
Crispr ID 906027052 906027070
Species Human (GRCh38) Human (GRCh38)
Location 1:42682679-42682701 1:42682732-42682754
Sequence CCCGGGCGGCCTCACATCGGCGG GTGAGGACCGGACAGGGACGGGG
Strand - +
Off-target summary {0: 3, 1: 0, 2: 1, 3: 6, 4: 59} {0: 1, 1: 0, 2: 1, 3: 14, 4: 202}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!