ID: 906065026_906065029

View in Genome Browser

Spacer: -8

Left Crispr Right Crispr
Crispr ID 906065026 906065029
Species Human (GRCh38) Human (GRCh38)
Location 1:42974654-42974676 1:42974669-42974691
Sequence CCTGATTTCACAGCTCTGATTCT CTGATTCTACAGAAGGAGGCCGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 2, 3: 21, 4: 261} {0: 1, 1: 0, 2: 2, 3: 17, 4: 272}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!