ID: 906068065_906068071

View in Genome Browser

Spacer: 3

Left Crispr Right Crispr
Crispr ID 906068065 906068071
Species Human (GRCh38) Human (GRCh38)
Location 1:42996427-42996449 1:42996453-42996475
Sequence CCTCTCATTCCTCTCCAGGGCAG CGCACTCTGATGGCCACATCTGG
Strand - +
Off-target summary No data No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!