ID: 906116938_906116953

View in Genome Browser

Spacer: 22

Left Crispr Right Crispr
Crispr ID 906116938 906116953
Species Human (GRCh38) Human (GRCh38)
Location 1:43363472-43363494 1:43363517-43363539
Sequence CCCGCCCACCCTGACCTTTGGCC TGGGGTGGAGGAGTGAGACTGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 26, 4: 368} {0: 1, 1: 1, 2: 8, 3: 44, 4: 567}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!