ID: 906124092_906124099

View in Genome Browser

Spacer: 0

Left Crispr Right Crispr
Crispr ID 906124092 906124099
Species Human (GRCh38) Human (GRCh38)
Location 1:43415975-43415997 1:43415998-43416020
Sequence CCAGACTCAGGGGACCTACTGGG CCGGAAGGTAGGCGTCTCCATGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 6, 3: 17, 4: 216} {0: 1, 1: 0, 2: 0, 3: 4, 4: 73}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!