ID: 906125173_906125191

View in Genome Browser

Spacer: 29

Left Crispr Right Crispr
Crispr ID 906125173 906125191
Species Human (GRCh38) Human (GRCh38)
Location 1:43423125-43423147 1:43423177-43423199
Sequence CCTGCGGCTGCGTTTCCCCCACC GTGAAACGAAAAGGGCTAGGGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 14, 4: 133} {0: 1, 1: 0, 2: 0, 3: 4, 4: 100}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!