ID: 906126200_906126208

View in Genome Browser

Spacer: 3

Left Crispr Right Crispr
Crispr ID 906126200 906126208
Species Human (GRCh38) Human (GRCh38)
Location 1:43428392-43428414 1:43428418-43428440
Sequence CCAAGTCCTGGTCCTCTCAGCCC GCCCTTCAGCAGCAGCATGGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 50, 4: 360} {0: 1, 1: 0, 2: 0, 3: 41, 4: 273}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!