ID: 906147770_906147783

View in Genome Browser

Spacer: 24

Left Crispr Right Crispr
Crispr ID 906147770 906147783
Species Human (GRCh38) Human (GRCh38)
Location 1:43570076-43570098 1:43570123-43570145
Sequence CCCTCCTCCTTCCCTGTAGCCTG CTTCTCTTTGCTTCCTCAGATGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 9, 3: 83, 4: 814} {0: 1, 1: 0, 2: 3, 3: 91, 4: 900}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!