ID: 906153565_906153568

View in Genome Browser

Spacer: 13

Left Crispr Right Crispr
Crispr ID 906153565 906153568
Species Human (GRCh38) Human (GRCh38)
Location 1:43601417-43601439 1:43601453-43601475
Sequence CCAGGCTCTGAGCTTGGCACTCA CTTGCTGACTGGCTTGCCCTTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 6, 3: 67, 4: 549} {0: 1, 1: 0, 2: 1, 3: 22, 4: 247}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!