ID: 906156562_906156572

View in Genome Browser

Spacer: 26

Left Crispr Right Crispr
Crispr ID 906156562 906156572
Species Human (GRCh38) Human (GRCh38)
Location 1:43617419-43617441 1:43617468-43617490
Sequence CCACCCGCTTTCTCCATTCTCTG CACGTGGGAGAATTCAAACCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 30, 4: 446} {0: 1, 1: 0, 2: 0, 3: 5, 4: 100}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!