ID: 906159011_906159018

View in Genome Browser

Spacer: 27

Left Crispr Right Crispr
Crispr ID 906159011 906159018
Species Human (GRCh38) Human (GRCh38)
Location 1:43633834-43633856 1:43633884-43633906
Sequence CCTGGGAGCTTTTTAGAAATGTA TGCCTGTAATCCCAGCACTTTGG
Strand - +
Off-target summary No data No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!