ID: 906161342_906161345

View in Genome Browser

Spacer: -9

Left Crispr Right Crispr
Crispr ID 906161342 906161345
Species Human (GRCh38) Human (GRCh38)
Location 1:43651047-43651069 1:43651061-43651083
Sequence CCATGCATTGTTCTAGGCATACA AGGCATACAAAGATGAATAGGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 3, 3: 36, 4: 317} {0: 1, 1: 0, 2: 5, 3: 47, 4: 670}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!