ID: 906196670_906196684

View in Genome Browser

Spacer: 17

Left Crispr Right Crispr
Crispr ID 906196670 906196684
Species Human (GRCh38) Human (GRCh38)
Location 1:43934232-43934254 1:43934272-43934294
Sequence CCTAGAAGAACAAGGTGCAGGAC GCTGGTGGATGGGGAGGCAAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 21, 4: 174} {0: 1, 1: 0, 2: 2, 3: 65, 4: 642}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!