ID: 906197260_906197268

View in Genome Browser

Spacer: -9

Left Crispr Right Crispr
Crispr ID 906197260 906197268
Species Human (GRCh38) Human (GRCh38)
Location 1:43936732-43936754 1:43936746-43936768
Sequence CCTCTCCGCCACCGCCTGCGGCT CCTGCGGCTGCCTGGGCTGAGGG
Strand - +
Off-target summary {0: 1, 1: 3, 2: 6, 3: 35, 4: 304} {0: 1, 1: 0, 2: 2, 3: 37, 4: 425}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!