ID: 906202663_906202667

View in Genome Browser

Spacer: 3

Left Crispr Right Crispr
Crispr ID 906202663 906202667
Species Human (GRCh38) Human (GRCh38)
Location 1:43970158-43970180 1:43970184-43970206
Sequence CCACCCAAGCTGTGCCTCATGGA GATGTTTAGCAGCCCTGCCGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 25, 4: 224} {0: 1, 1: 0, 2: 0, 3: 4, 4: 58}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!