ID: 906234412_906234417

View in Genome Browser

Spacer: 3

Left Crispr Right Crispr
Crispr ID 906234412 906234417
Species Human (GRCh38) Human (GRCh38)
Location 1:44195870-44195892 1:44195896-44195918
Sequence CCTCAATTGGCATTAGTCCACCC AATTTGCATGTAATCGAAAGTGG
Strand - +
Off-target summary No data {0: 1, 1: 24, 2: 107, 3: 217, 4: 354}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!