ID: 906237204_906237218

View in Genome Browser

Spacer: 29

Left Crispr Right Crispr
Crispr ID 906237204 906237218
Species Human (GRCh38) Human (GRCh38)
Location 1:44219239-44219261 1:44219291-44219313
Sequence CCGGTGCGGAGGTTCCGCCAGCC AAGGCCTCACCCCGAGTGGAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 89} {0: 1, 1: 0, 2: 0, 3: 12, 4: 99}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!