ID: 906252442_906252448

View in Genome Browser

Spacer: 2

Left Crispr Right Crispr
Crispr ID 906252442 906252448
Species Human (GRCh38) Human (GRCh38)
Location 1:44321119-44321141 1:44321144-44321166
Sequence CCAGGAAAGCCAGGTATCCTCCC CAAAACATACCCACTAATATTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 55, 4: 205} {0: 1, 1: 0, 2: 3, 3: 9, 4: 142}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!