ID: 906255914_906255917

View in Genome Browser

Spacer: -4

Left Crispr Right Crispr
Crispr ID 906255914 906255917
Species Human (GRCh38) Human (GRCh38)
Location 1:44350044-44350066 1:44350063-44350085
Sequence CCATCAGTCTTCTACAAGCAAGG AAGGAAAGGAGAAACCAAATAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 8, 4: 125} {0: 1, 1: 0, 2: 5, 3: 88, 4: 867}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!