ID: 906311501_906311505

View in Genome Browser

Spacer: -9

Left Crispr Right Crispr
Crispr ID 906311501 906311505
Species Human (GRCh38) Human (GRCh38)
Location 1:44757753-44757775 1:44757767-44757789
Sequence CCCATCACCAGATAGCCTTGCCA GCCTTGCCATGTCAGATGCAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 101} {0: 1, 1: 0, 2: 1, 3: 8, 4: 124}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!