ID: 906319881_906319891

View in Genome Browser

Spacer: 30

Left Crispr Right Crispr
Crispr ID 906319881 906319891
Species Human (GRCh38) Human (GRCh38)
Location 1:44809227-44809249 1:44809280-44809302
Sequence CCCTCCTCCCTCCACTCACTCAG GAGGAACAGATGACCTGTTCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 5, 3: 107, 4: 1132} {0: 1, 1: 0, 2: 0, 3: 13, 4: 118}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!