ID: 906322914_906322919

View in Genome Browser

Spacer: 11

Left Crispr Right Crispr
Crispr ID 906322914 906322919
Species Human (GRCh38) Human (GRCh38)
Location 1:44827802-44827824 1:44827836-44827858
Sequence CCAGAGATGCTAAGTCTCTGCCC GTCTTACCTTAGCATGTGACTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 158} {0: 1, 1: 0, 2: 0, 3: 7, 4: 53}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!