ID: 906323952_906323958

View in Genome Browser

Spacer: 14

Left Crispr Right Crispr
Crispr ID 906323952 906323958
Species Human (GRCh38) Human (GRCh38)
Location 1:44832745-44832767 1:44832782-44832804
Sequence CCAATAGGGGCCAATAGGGAGGC TTTCCTAAAAGAACAGGTGTAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 55} {0: 1, 1: 0, 2: 3, 3: 23, 4: 251}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!