ID: 906346137_906346144

View in Genome Browser

Spacer: 27

Left Crispr Right Crispr
Crispr ID 906346137 906346144
Species Human (GRCh38) Human (GRCh38)
Location 1:45015757-45015779 1:45015807-45015829
Sequence CCAGAACTACATGGGGTAGGGTA CATTTGCAGAAAAACGGGTGGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 4, 4: 68} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!