ID: 906349583_906349586

View in Genome Browser

Spacer: -1

Left Crispr Right Crispr
Crispr ID 906349583 906349586
Species Human (GRCh38) Human (GRCh38)
Location 1:45046541-45046563 1:45046563-45046585
Sequence CCTACTGAGATGCCTGTTAACAG GATAAATGGAGATATCAAAAAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 133} {0: 1, 1: 0, 2: 7, 3: 36, 4: 584}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!