ID: 906356888_906356902

View in Genome Browser

Spacer: 13

Left Crispr Right Crispr
Crispr ID 906356888 906356902
Species Human (GRCh38) Human (GRCh38)
Location 1:45115136-45115158 1:45115172-45115194
Sequence CCGGTTCCCAGTGAGCTGTTGGG CGGGGTGGCCGCCGGGCAGAGGG
Strand - +
Off-target summary {0: 3, 1: 48, 2: 1425, 3: 546, 4: 267} {0: 5, 1: 305, 2: 1494, 3: 1847, 4: 1618}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!