|
Left Crispr |
Right Crispr |
Crispr ID |
906356890 |
906356902 |
Species |
Human (GRCh38) |
Human (GRCh38) |
Location |
1:45115142-45115164
|
1:45115172-45115194
|
Sequence |
CCCAGTGAGCTGTTGGGTACACC |
CGGGGTGGCCGCCGGGCAGAGGG |
Strand |
- |
+ |
Off-target summary |
{0: 3, 1: 4, 2: 11, 3: 15, 4: 190} |
{0: 5, 1: 305, 2: 1494, 3: 1847, 4: 1618} |
Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
No off target data available for this pair!
|