ID: 906356891_906356902

View in Genome Browser

Spacer: 6

Left Crispr Right Crispr
Crispr ID 906356891 906356902
Species Human (GRCh38) Human (GRCh38)
Location 1:45115143-45115165 1:45115172-45115194
Sequence CCAGTGAGCTGTTGGGTACACCT CGGGGTGGCCGCCGGGCAGAGGG
Strand - +
Off-target summary {0: 3, 1: 4, 2: 14, 3: 16, 4: 180} {0: 5, 1: 305, 2: 1494, 3: 1847, 4: 1618}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!