ID: 906369949_906369957

View in Genome Browser

Spacer: 20

Left Crispr Right Crispr
Crispr ID 906369949 906369957
Species Human (GRCh38) Human (GRCh38)
Location 1:45245045-45245067 1:45245088-45245110
Sequence CCCTCTCCCTTCTAAAGATGAGC AAAAGGATAAAGCAGGGAAAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 31, 4: 274} {0: 1, 1: 0, 2: 9, 3: 116, 4: 1318}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!