ID: 906375340_906375342

View in Genome Browser

Spacer: -2

Left Crispr Right Crispr
Crispr ID 906375340 906375342
Species Human (GRCh38) Human (GRCh38)
Location 1:45292189-45292211 1:45292210-45292232
Sequence CCTTCCAGGGCTCTGGGCTACTC TCAGAGATTTGACAGAAATGTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 31, 4: 305} {0: 1, 1: 0, 2: 2, 3: 39, 4: 313}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!