ID: 906423096_906423110

View in Genome Browser

Spacer: 8

Left Crispr Right Crispr
Crispr ID 906423096 906423110
Species Human (GRCh38) Human (GRCh38)
Location 1:45687091-45687113 1:45687122-45687144
Sequence CCAGTCCCCAGCGGGCCACACGG CGGAGGCTGCGCGGCTGCGTCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 11, 4: 180} {0: 1, 1: 1, 2: 1, 3: 14, 4: 147}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!