ID: 906433119_906433127

View in Genome Browser

Spacer: 11

Left Crispr Right Crispr
Crispr ID 906433119 906433127
Species Human (GRCh38) Human (GRCh38)
Location 1:45772228-45772250 1:45772262-45772284
Sequence CCATCCACCTTGGGCTTCCCAAG TAGGTATGAGCTACCATGCCTGG
Strand - +
Off-target summary No data {0: 4, 1: 190, 2: 3583, 3: 26372, 4: 82677}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!