ID: 906436399_906436406

View in Genome Browser

Spacer: 3

Left Crispr Right Crispr
Crispr ID 906436399 906436406
Species Human (GRCh38) Human (GRCh38)
Location 1:45800534-45800556 1:45800560-45800582
Sequence CCAAGTTGTGTGGGCTGTGTTCC CTGGGTGCTCAACTGGAGAAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 145} {0: 1, 1: 0, 2: 0, 3: 15, 4: 238}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!