ID: 906447689_906447698

View in Genome Browser

Spacer: 21

Left Crispr Right Crispr
Crispr ID 906447689 906447698
Species Human (GRCh38) Human (GRCh38)
Location 1:45917512-45917534 1:45917556-45917578
Sequence CCAGCCGCCCACTGCCGTGGAGG TGGGCCTTGACAATTGCTTCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 19, 4: 152} {0: 1, 1: 0, 2: 1, 3: 14, 4: 101}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!