ID: 906471202_906471211

View in Genome Browser

Spacer: -7

Left Crispr Right Crispr
Crispr ID 906471202 906471211
Species Human (GRCh38) Human (GRCh38)
Location 1:46132695-46132717 1:46132711-46132733
Sequence CCACCCGCTGAGGCGCCACCCAA CACCCAACCGCGCCGGGAGGGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 76} {0: 1, 1: 0, 2: 0, 3: 5, 4: 82}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!