ID: 906483331_906483341

View in Genome Browser

Spacer: 25

Left Crispr Right Crispr
Crispr ID 906483331 906483341
Species Human (GRCh38) Human (GRCh38)
Location 1:46215755-46215777 1:46215803-46215825
Sequence CCAGGTGTAGGTACATGCCTGTA AGGAGGGTTGCTTGAGCTCAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 4, 3: 50, 4: 304} {0: 1, 1: 32, 2: 351, 3: 1378, 4: 3717}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!