ID: 906556623_906556631

View in Genome Browser

Spacer: 17

Left Crispr Right Crispr
Crispr ID 906556623 906556631
Species Human (GRCh38) Human (GRCh38)
Location 1:46719116-46719138 1:46719156-46719178
Sequence CCTTTGGCAGCGGCCGCCTGCGC CACTCCCATTGGTCGCCCGCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 132} {0: 1, 1: 0, 2: 0, 3: 2, 4: 27}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!