ID: 906561798_906561807

View in Genome Browser

Spacer: 30

Left Crispr Right Crispr
Crispr ID 906561798 906561807
Species Human (GRCh38) Human (GRCh38)
Location 1:46763697-46763719 1:46763750-46763772
Sequence CCAGGCTCCCTCTGTGTAAAGCC TCACAGACTCCTGGTTGCCAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 12, 4: 165} {0: 1, 1: 1, 2: 2, 3: 35, 4: 288}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!